Supplementary files of Mutant calreticulin enables potent and selective CAR-T cell therapy in preclinical models of myeloproliferative neoplasms [dataset]

Under a Creative Commons BY - NC 4.0 license.-- Material and methods: Cell lines culture, genetic modifications, and drug treatment. The MARIMO (Acute myeloid leukemia), HEL (Erythroleukaemia cells homozygous for JAK2 V617F mutation), K562 (Chronic myelogenous leukemia, BCR-Abl+), and THP-1 (Acute m...

Descripción completa

Detalles Bibliográficos
Autores: Pesini, Cecilia, Gil Bellido, Mario, Millan, Lorena S., Oñate, Carmen, Calvo Pérez, Adanays, Santiago, Llipsy, Iglesias, Eldris, Bernal, Jorge Paúl, Araujo-Voces, Miguel, Paz Artigas, Laura, García-Martínez, Laura, Roig, Francisco J., Movilla, Nieves, García-Aznar, José Manuel, Olave, María Teresa, Azaceta, Gemma, Garrote, Marta, Alvarez-Larrán, A., Gálvez Buerba, Eva Mª, Sánchez Martínez, Diego, Arias, Maykel, Pardo, Julián, Ramírez-Labrada, Ariel
Tipo de recurso: conjunto de datos
Fecha de publicación:2026
País:España
Institución:Consejo Superior de Investigaciones Científicas (CSIC)
Repositorio:DIGITAL.CSIC. Repositorio Institucional del CSIC
OAI Identifier:oai:digital.csic.es:10261/425635
Acceso en línea:http://hdl.handle.net/10261/425635
Access Level:acceso abierto
Palabra clave:Adoptive cell therapy - ACT
Chimeric antigen receptor - CAR
Coagulopathy
Hematologic malignancies
Immunotherapy
http://metadata.un.org/sdg/3
Ensure healthy lives and promote well-being for all at all ages
Pathology
id ES_b91c39d424948ec9aa35c96f7ca9604d
oai_identifier_str oai:digital.csic.es:10261/425635
network_acronym_str ES
network_name_str España
repository_id_str
dc.title.none.fl_str_mv Supplementary files of Mutant calreticulin enables potent and selective CAR-T cell therapy in preclinical models of myeloproliferative neoplasms [dataset]
title Supplementary files of Mutant calreticulin enables potent and selective CAR-T cell therapy in preclinical models of myeloproliferative neoplasms [dataset]
spellingShingle Supplementary files of Mutant calreticulin enables potent and selective CAR-T cell therapy in preclinical models of myeloproliferative neoplasms [dataset]
Pesini, Cecilia
Adoptive cell therapy - ACT
Chimeric antigen receptor - CAR
Coagulopathy
Hematologic malignancies
Immunotherapy
http://metadata.un.org/sdg/3
Ensure healthy lives and promote well-being for all at all ages
Pathology
title_short Supplementary files of Mutant calreticulin enables potent and selective CAR-T cell therapy in preclinical models of myeloproliferative neoplasms [dataset]
title_full Supplementary files of Mutant calreticulin enables potent and selective CAR-T cell therapy in preclinical models of myeloproliferative neoplasms [dataset]
title_fullStr Supplementary files of Mutant calreticulin enables potent and selective CAR-T cell therapy in preclinical models of myeloproliferative neoplasms [dataset]
title_full_unstemmed Supplementary files of Mutant calreticulin enables potent and selective CAR-T cell therapy in preclinical models of myeloproliferative neoplasms [dataset]
title_sort Supplementary files of Mutant calreticulin enables potent and selective CAR-T cell therapy in preclinical models of myeloproliferative neoplasms [dataset]
dc.creator.none.fl_str_mv Pesini, Cecilia
Gil Bellido, Mario
Millan, Lorena S.
Oñate, Carmen
Calvo Pérez, Adanays
Santiago, Llipsy
Iglesias, Eldris
Bernal, Jorge Paúl
Araujo-Voces, Miguel
Paz Artigas, Laura
García-Martínez, Laura
Roig, Francisco J.
Movilla, Nieves
García-Aznar, José Manuel
Olave, María Teresa
Azaceta, Gemma
Garrote, Marta
Alvarez-Larrán, A.
Gálvez Buerba, Eva Mª
Sánchez Martínez, Diego
Arias, Maykel
Pardo, Julián
Ramírez-Labrada, Ariel
author Pesini, Cecilia
author_facet Pesini, Cecilia
Gil Bellido, Mario
Millan, Lorena S.
Oñate, Carmen
Calvo Pérez, Adanays
Santiago, Llipsy
Iglesias, Eldris
Bernal, Jorge Paúl
Araujo-Voces, Miguel
Paz Artigas, Laura
García-Martínez, Laura
Roig, Francisco J.
Movilla, Nieves
García-Aznar, José Manuel
Olave, María Teresa
Azaceta, Gemma
Garrote, Marta
Alvarez-Larrán, A.
Gálvez Buerba, Eva Mª
Sánchez Martínez, Diego
Arias, Maykel
Pardo, Julián
Ramírez-Labrada, Ariel
author_role author
author2 Gil Bellido, Mario
Millan, Lorena S.
Oñate, Carmen
Calvo Pérez, Adanays
Santiago, Llipsy
Iglesias, Eldris
Bernal, Jorge Paúl
Araujo-Voces, Miguel
Paz Artigas, Laura
García-Martínez, Laura
Roig, Francisco J.
Movilla, Nieves
García-Aznar, José Manuel
Olave, María Teresa
Azaceta, Gemma
Garrote, Marta
Alvarez-Larrán, A.
Gálvez Buerba, Eva Mª
Sánchez Martínez, Diego
Arias, Maykel
Pardo, Julián
Ramírez-Labrada, Ariel
author2_role author
author
author
author
author
author
author
author
author
author
author
author
author
author
author
author
author
author
author
author
author
author
dc.contributor.none.fl_str_mv Instituto de Salud Carlos III
Ministerio de Ciencia, Innovación y Universidades (España)
Agencia Estatal de Investigación (España)
European Commission
Aspanoa
Gobierno de Aragón
Red Española de Terapias Avanzadas
Faro La Rioja
Asociación Española Contra el Cáncer
Dona Médula Aragón
Asociación Carrera de la Mujer Ciudad de Monzón
Universidad de Zaragoza
Banco Santander
European Research Council
Pesini, Cecilia [0000-0002-8707-2722]
Oñate, Carmen [0000-0001-6949-3462]
Calvo Pérez, Adanays [0000-0002-1040-977X]
Santiago, Llipsy [0000-0002-1861-5981]
Iglesias, Eldris [0009-0006-3761-3021]
Bernal, Jorge Paúl [0009-0004-3238-742X]
Araujo-Voces, Miguel [0000-0003-3360-4479]
Paz Artigas, Laura [0000-0001-6139-5905]
Roig, Francisco J. [0000-0002-8853-2428]
Movilla, Nieves [0000-0002-0163-8378]
García-Aznar, José Manuel [0000-0002-9864-7683]
Olave, María Teresa [0000-0002-6326-5992]
Azaceta, Gemma [0000-0001-5068-7355]
Garrote, Marta [0000-0001-8571-1466]
Gálvez Buerba, Eva Mª [0000-0001-6928-5516]
Arias, Maykel [0000-0002-9730-2210]
Pardo, Julián [0000-0003-0154-0730]
Ramírez-Labrada, Ariel [0000-0002-3888-7036]
Ramírez-Labrada, Ariel [aramirezlabrada@yahoo.es]
Consejo Superior de Investigaciones Científicas [https://ror.org/02gfc7t72]
dc.subject.none.fl_str_mv Adoptive cell therapy - ACT
Chimeric antigen receptor - CAR
Coagulopathy
Hematologic malignancies
Immunotherapy
http://metadata.un.org/sdg/3
Ensure healthy lives and promote well-being for all at all ages
Pathology
topic Adoptive cell therapy - ACT
Chimeric antigen receptor - CAR
Coagulopathy
Hematologic malignancies
Immunotherapy
http://metadata.un.org/sdg/3
Ensure healthy lives and promote well-being for all at all ages
Pathology
description Under a Creative Commons BY - NC 4.0 license.-- Material and methods: Cell lines culture, genetic modifications, and drug treatment. The MARIMO (Acute myeloid leukemia), HEL (Erythroleukaemia cells homozygous for JAK2 V617F mutation), K562 (Chronic myelogenous leukemia, BCR-Abl+), and THP-1 (Acute monocytic leukemia, JAK2 wt) cell lines were cultured in RPMI medium (Sigma-Aldrich). The Steffen Koschmieder laboratory kindly provided the MARIMO cell line after an MTA agreement with the Yuichi Ishikawa laboratory. HEK293T, A549, HepG2, PANC-1, PC-3, MDA-MB-231, and NHCF-v cell lines were cultured in DMEM (Sigma-Aldrich). Mediums were supplemented with 10% fetal bovine serum (FBS, Capricorn Scientific) and 1% penicillin/streptomycin (Pen/Strep, Sigma-Aldrich). HEL, K562, and THP-1 tumor cell lines were genetically modified to express ZsGreen-FireFly Luciferase (ZsGreen-FFLuc) and mutated calreticulin (mCALR) using lentiviral particles, obtained by co-transfecting HEK293T cells with the psPAX2 (Addgene #12260), the pMD2.G plasmids (Addgene #12259), and the lentiviral interest plasmid (pCCL1 Luc-T2A-ZsGreen and pCCL1 mCALR-T2A-RFP), by using PEI (Sigma-Aldrich). The mCALR sequence identified in the MARIMO cell line (del61), resembling a type 1-like mutation, was used to transduce HEL, K562, and THP-1 cell lines. All resulting cell lines expressed luciferase, ZsGreen (wt), and mCALR-expressing cells (mCALR+) co-expressed RFP protein. Fluorescence-activated cell sorting was used to isolate modified cell populations based on fluorescent protein expression, and mCALR expression was validated by flow cytometry and immunoblotting. Proliferation was evaluated between wild-type and mCAR+ derivative cell lines by Incucyte (Supplementary Figure 2). To knock out mCALR in MARIMO cells, a lentiviral CRISPR/Cas9 system was employed using the lentiCRISPRv2 (Addgene #52961) and lentiGuide-Puro (Addgene #52963) plasmids. A specific single guide RNA (sgRNA) targeting the mCALR was designed following the system requirements and cloned into the BsmBI site of the lentiCRISPRv2 vector following the protocol by Shalem et al. 1. The oligo sequences used were: (oligo 1: CACCGACGAGGAGCAGAGGATGATG, oligo 2:AAACCATCATCCTCTGCTCCTCGTC, Life Technologies). Loss of mutant CALR expression was confirmed by immunoblotting (see below). For venetoclax treatment, the IC50 was determined for each cell line, and a dose below the calculated IC50 was selected for subsequent experiments (Supplementary Figure 15). hiPSC differentiation into cardiomyocytes (hiPSC-CMs) Human induced pluripotent stem cells (hiPSCs; IPSC0028, Sigma-Aldrich) were differentiated into cardiomyocytes. Briefly, hiPSCs were seeded on Matrigel-coated plates (Corning) at a density of 1.5 × 10⁵ cells/cm² in Essential 8 (E8) medium (Gibco). After 48 h, differentiation was induced using RPMI medium (Biowest) supplemented with B27 minus insulin (Gibco) and 9 μM CHIR99021 (Sigma-Aldrich) for 24 h, followed by 48 h in RPMI B27⁻. The medium was then replaced with a 1:1 mixture of conditioned and fresh RPMI B27⁻ containing 5 μM IWP2 (Labclinics) for 48 h, and subsequently with fresh RPMI B27⁻ for an additional 48 h. Cultures were then maintained in RPMI supplemented with B27 plus insulin (RPMI B27⁺) for 72 h. Cardiomyocytes were purified by 48 h incubation in glucose-free RPMI B27⁺ medium (Gibco) and passaged using TrypLE (Gibco). Cells were reseeded on Matrigel-coated plates in RPMI B27⁺ supplemented with 10 μM Y-27632 (Stem Cell Technologies) and 10% KnockOut serum (Gibco). After 24 h, medium was replaced with RPMI B27⁺ containing 2 μM CHIR99021 (expansion medium), refreshed every 48–72 h. Cells were expanded for up to four passages before use. To monitor hiPSC-CM purity, cells were analyzed by flow cytometry after each passage using cardiac Troponin T (cTnT) as a marker. Cells were fixed with 2% paraformaldehyde for 15 min at 4 °C, permeabilized and blocked with 0.1% saponin (MilliporeSigma) and 10% donkey serum (Sigma-Aldrich), and stained with BV421-conjugated anti-cTnT antibody (clone 13-11, BD Biosciences, 1:200). Samples were washed with PBS and analyzed by flow cytometry. Differentiation batches with <80% cTnT⁺ cells were excluded from experiments. Selection of single-chain variable fragment (scFv) and CAR construct design The mutated calreticulin-specific single-chain variable fragments (scFvs) were derived from different previously described antibodies: mCALR-CAR0, from the 8B2-H6 antibody (WO 2016/087514); mCALR-CAR1, from the B3 antibody (WO 2020/175689 A1); mCALR-CAR2, from antibody clone 4; mCALR-CAR3, from antibody clone 74; and mCALR-CAR4, from antibody clone 132 (all from WO 2023/107994, Supplementary Figure 16). The construct included a human CD8 hinge, a human CD8 transmembrane domain, a human 4-1BB endodomain, and the ζ signaling endodomain of the T cell receptor complex (CD3ζ). Additionally, a T2A-enhanced green fluorescent protein (ZsGreen) sequence was incorporated. The construct was synthesized commercially (GenScript) and cloned into a pCCL1 lentiviral backbone. An identical lentiviral vector expressing ZsGreen alone was used as a control (mock) where indicated.
publishDate 2026
dc.date.none.fl_str_mv 2026
2026
2026
dc.type.none.fl_str_mv info:eu-repo/semantics/dataset
http://purl.org/coar/resource_type/c_ddb1
format dataset
dc.identifier.none.fl_str_mv http://hdl.handle.net/10261/425635
url http://hdl.handle.net/10261/425635
dc.language.none.fl_str_mv Inglés
language_invalid_str_mv Inglés
dc.relation.none.fl_str_mv #PLACEHOLDER_PARENT_METADATA_VALUE#
#PLACEHOLDER_PARENT_METADATA_VALUE#
#PLACEHOLDER_PARENT_METADATA_VALUE#
#PLACEHOLDER_PARENT_METADATA_VALUE#
info:eu-repo/grantAgreement/AEI/Plan Estatal de Investigación Científica y Técnica y de Innovación 2017-2020/PID2020-113963RB-I00
info:eu-repo/grantAgreement/AEI/Plan Estatal de Investigación Científica y Técnica y de Innovación 2024-2027/PID2024-157582OB-I00
info:eu-repo/grantAgreement/AEI/Plan Estatal de Investigación Científica y Técnica y de Innovación 2021-2023/PID2022-136554OA-I00
info:eu-repo/grantAgreement/ERC//101018587
Pesini, Cecilia; Gil Bellido, Mario; Millan, Lorena S.; Oñate, Carmen; Calvo Pérez, Adanays; Santiago, Llipsy; Iglesias, Eldris; Bernal, Jorge Paúl; Araujo-Voces, Miguel; Paz Artigas, Laura; García-Martínez, Laura; Roig, Francisco J.; Movilla, Nieves; García-Aznar, José Manuel; Olave, María Teresa; Azaceta, Gemma; Garrote, Marta; Alvarez-Larrán, A.; Gálvez Buerba, Eva Mª; Sánchez Martínez, Diego; Arias, Maykel; Pardo, Julián; Ramírez-Labrada, Ariel. Mutant calreticulin enables potent and selective CAR-T cell therapy in preclinical models of myeloproliferative neoplasms. http://dx.doi.org/10.1136/jitc-2025-012706. http://hdl.handle.net/10261/418999
http://dx.doi.org/10.1136/jitc-2025-012706
https://jitc.bmj.com/content/jitc/14/1/e012706/DC1/embed/inline-supplementary-material-1.pdf
https://jitc.bmj.com/content/jitc/14/1/e012706/DC2/embed/inline-supplementary-material-2.pdf
https://jitc.bmj.com/content/jitc/14/1/e012706/DC3/embed/inline-supplementary-material-3.pdf

dc.rights.none.fl_str_mv info:eu-repo/semantics/openAccess
eu_rights_str_mv openAccess
dc.format.none.fl_str_mv application/pdf
dc.publisher.none.fl_str_mv BMJ Publishing Group
publisher.none.fl_str_mv BMJ Publishing Group
dc.source.none.fl_str_mv reponame:DIGITAL.CSIC. Repositorio Institucional del CSIC
instname:Consejo Superior de Investigaciones Científicas (CSIC)
instname_str Consejo Superior de Investigaciones Científicas (CSIC)
reponame_str DIGITAL.CSIC. Repositorio Institucional del CSIC
collection DIGITAL.CSIC. Repositorio Institucional del CSIC
repository.name.fl_str_mv
repository.mail.fl_str_mv
_version_ 1869417725411983360
spelling Supplementary files of Mutant calreticulin enables potent and selective CAR-T cell therapy in preclinical models of myeloproliferative neoplasms [dataset]Pesini, CeciliaGil Bellido, MarioMillan, Lorena S.Oñate, CarmenCalvo Pérez, AdanaysSantiago, LlipsyIglesias, EldrisBernal, Jorge PaúlAraujo-Voces, MiguelPaz Artigas, LauraGarcía-Martínez, LauraRoig, Francisco J.Movilla, NievesGarcía-Aznar, José ManuelOlave, María TeresaAzaceta, GemmaGarrote, MartaAlvarez-Larrán, A.Gálvez Buerba, Eva MªSánchez Martínez, DiegoArias, MaykelPardo, JuliánRamírez-Labrada, ArielAdoptive cell therapy - ACTChimeric antigen receptor - CARCoagulopathyHematologic malignanciesImmunotherapyhttp://metadata.un.org/sdg/3Ensure healthy lives and promote well-being for all at all agesPathologyUnder a Creative Commons BY - NC 4.0 license.-- Material and methods: Cell lines culture, genetic modifications, and drug treatment. The MARIMO (Acute myeloid leukemia), HEL (Erythroleukaemia cells homozygous for JAK2 V617F mutation), K562 (Chronic myelogenous leukemia, BCR-Abl+), and THP-1 (Acute monocytic leukemia, JAK2 wt) cell lines were cultured in RPMI medium (Sigma-Aldrich). The Steffen Koschmieder laboratory kindly provided the MARIMO cell line after an MTA agreement with the Yuichi Ishikawa laboratory. HEK293T, A549, HepG2, PANC-1, PC-3, MDA-MB-231, and NHCF-v cell lines were cultured in DMEM (Sigma-Aldrich). Mediums were supplemented with 10% fetal bovine serum (FBS, Capricorn Scientific) and 1% penicillin/streptomycin (Pen/Strep, Sigma-Aldrich). HEL, K562, and THP-1 tumor cell lines were genetically modified to express ZsGreen-FireFly Luciferase (ZsGreen-FFLuc) and mutated calreticulin (mCALR) using lentiviral particles, obtained by co-transfecting HEK293T cells with the psPAX2 (Addgene #12260), the pMD2.G plasmids (Addgene #12259), and the lentiviral interest plasmid (pCCL1 Luc-T2A-ZsGreen and pCCL1 mCALR-T2A-RFP), by using PEI (Sigma-Aldrich). The mCALR sequence identified in the MARIMO cell line (del61), resembling a type 1-like mutation, was used to transduce HEL, K562, and THP-1 cell lines. All resulting cell lines expressed luciferase, ZsGreen (wt), and mCALR-expressing cells (mCALR+) co-expressed RFP protein. Fluorescence-activated cell sorting was used to isolate modified cell populations based on fluorescent protein expression, and mCALR expression was validated by flow cytometry and immunoblotting. Proliferation was evaluated between wild-type and mCAR+ derivative cell lines by Incucyte (Supplementary Figure 2). To knock out mCALR in MARIMO cells, a lentiviral CRISPR/Cas9 system was employed using the lentiCRISPRv2 (Addgene #52961) and lentiGuide-Puro (Addgene #52963) plasmids. A specific single guide RNA (sgRNA) targeting the mCALR was designed following the system requirements and cloned into the BsmBI site of the lentiCRISPRv2 vector following the protocol by Shalem et al. 1. The oligo sequences used were: (oligo 1: CACCGACGAGGAGCAGAGGATGATG, oligo 2:AAACCATCATCCTCTGCTCCTCGTC, Life Technologies). Loss of mutant CALR expression was confirmed by immunoblotting (see below). For venetoclax treatment, the IC50 was determined for each cell line, and a dose below the calculated IC50 was selected for subsequent experiments (Supplementary Figure 15). hiPSC differentiation into cardiomyocytes (hiPSC-CMs) Human induced pluripotent stem cells (hiPSCs; IPSC0028, Sigma-Aldrich) were differentiated into cardiomyocytes. Briefly, hiPSCs were seeded on Matrigel-coated plates (Corning) at a density of 1.5 × 10⁵ cells/cm² in Essential 8 (E8) medium (Gibco). After 48 h, differentiation was induced using RPMI medium (Biowest) supplemented with B27 minus insulin (Gibco) and 9 μM CHIR99021 (Sigma-Aldrich) for 24 h, followed by 48 h in RPMI B27⁻. The medium was then replaced with a 1:1 mixture of conditioned and fresh RPMI B27⁻ containing 5 μM IWP2 (Labclinics) for 48 h, and subsequently with fresh RPMI B27⁻ for an additional 48 h. Cultures were then maintained in RPMI supplemented with B27 plus insulin (RPMI B27⁺) for 72 h. Cardiomyocytes were purified by 48 h incubation in glucose-free RPMI B27⁺ medium (Gibco) and passaged using TrypLE (Gibco). Cells were reseeded on Matrigel-coated plates in RPMI B27⁺ supplemented with 10 μM Y-27632 (Stem Cell Technologies) and 10% KnockOut serum (Gibco). After 24 h, medium was replaced with RPMI B27⁺ containing 2 μM CHIR99021 (expansion medium), refreshed every 48–72 h. Cells were expanded for up to four passages before use. To monitor hiPSC-CM purity, cells were analyzed by flow cytometry after each passage using cardiac Troponin T (cTnT) as a marker. Cells were fixed with 2% paraformaldehyde for 15 min at 4 °C, permeabilized and blocked with 0.1% saponin (MilliporeSigma) and 10% donkey serum (Sigma-Aldrich), and stained with BV421-conjugated anti-cTnT antibody (clone 13-11, BD Biosciences, 1:200). Samples were washed with PBS and analyzed by flow cytometry. Differentiation batches with <80% cTnT⁺ cells were excluded from experiments. Selection of single-chain variable fragment (scFv) and CAR construct design The mutated calreticulin-specific single-chain variable fragments (scFvs) were derived from different previously described antibodies: mCALR-CAR0, from the 8B2-H6 antibody (WO 2016/087514); mCALR-CAR1, from the B3 antibody (WO 2020/175689 A1); mCALR-CAR2, from antibody clone 4; mCALR-CAR3, from antibody clone 74; and mCALR-CAR4, from antibody clone 132 (all from WO 2023/107994, Supplementary Figure 16). The construct included a human CD8 hinge, a human CD8 transmembrane domain, a human 4-1BB endodomain, and the ζ signaling endodomain of the T cell receptor complex (CD3ζ). Additionally, a T2A-enhanced green fluorescent protein (ZsGreen) sequence was incorporated. The construct was synthesized commercially (GenScript) and cloned into a pCCL1 lentiviral backbone. An identical lentiviral vector expressing ZsGreen alone was used as a control (mock) where indicated.Lentiviral Particle Production and T-cell Transduction, Activation, and Expansion To produce viral supernatant, HEK293T cells were co-transfected with the CAR-encoding pCCL1 lentiviral plasmid, the RRE and Rev plasmids, and a plasmid containing the sequence for the VSV-G envelope (kindly provided by Pablo Menéndez’s laboratory). Plasmid transfection was carried out using PEI for 5 hours. Viral supernatants were collected at 48 and 72 hours posttransfection and ultracentrifuged (26000 rpm, 2.5 hours at 4°C, Sorvall WX+, Thermo Scientific). The concentrated supernatant was then titrated in HEK293T cells to determine viral titer for consistent infections. PBMCs were isolated from blood samples of HDs or MPN patients using Ficoll Paque Plus (Merk) gradient centrifugation (PI24/276). Primary human T cells were cultured in RPMI 1640 supplemented with 10% heat-inactivated FBS and 100 U/mL penicillin/streptomycin at 37°C in a 5% CO₂ incubator. T cells were activated using plate-bound anti-CD3 (OKT3) and anti-CD28 (BD Biosciences). After 24 hours, human IL-7 and IL-15 (Miltenyi Biotec) were added at a final concentration of 10 ng/mL. The next day, T cells were seeded into a new plate and transduced with lentiviral CAR vectors at a multiplicity of infection of 30. Proper CAR cell generation was confirmed by eGFP expression and CAR surface expression through extracellular labeling of the scFv using a Biotin-AffiniPure F(ab’)2 Fragment Goat Anti-Mouse IgG (H+L) or Biotin- AffiniPure F(ab’)₂ Fragment Goat Anti-Human IgG (H+L) (Jackson ImmunoResearch Laboratories) followed by incubation with Streptavidin-PE (Miltenyi Biotech) and analyzed by flow cytometry. In Vitro Cytotoxicity Assays and Cytokine Release Determination T cells expressing different CAR-T constructs were co-cultured with target cells at the indicated E:T ratios for 24 to 48 hours to evaluate cytotoxicity. Wells containing only target cells served as controls for normalization. Comparisons were made between mCALR⁺ target cells co-cultured with CAR-transduced T cells and appropriate reference groups, depending on the experimental setup: against mCALR⁻ target cells co-cultured with CAR-T cells or against mCALR+ cells cocultured with non-transduced T cells. Experiments were conducted with a normalized CAR expression level of 35% to compare the different CAR constructs. Cytotoxicity was assessed using both Incucyte-based live-cell imaging and a luciferase-based viability assay. For the Incucyte assays, co-cultures were imaged every 6 hours for up to 48 hours using the Incucyte Live-Cell Analysis System (Sartorius). Red fluorescence intensity was used to quantify target cell survival. Viability was calculated as the percentage of the red fluorescence area relative to control wells at each time point, using the following formula: Viability (%) = (Orange fluorescence area of test wells at t / t₀) / (Orange fluorescence area of control wells at t / t₀) × 100, with analysis performed using Incucyte Analysis Software. In the luciferase-based assay, luciferase activity was measured at 24 and 48 hours post co-culture using D-luciferin (BioVision), and luminescence was recorded with a BioTek Microplate Reader (Agilent). Cell viability was calculated based on the percentage of luminescence relative to control wells using the formula: Viability (%) = (Luminescence of test wells / Luminescence of control wells) × 100. The production of the proinflammatory cytokine interferon-γ (IFN-γ) was measured in cytotoxicity assay supernatants using an enzyme-linked immunosorbent assay (ELISA) from BD Biosciences. Additionally, the multiplex immunoassay quantified TNFα, IL6, IL10, CXCL10, MIP1A/B, IL2, IL13, and IL5 using a customized multiplex immunoassay from R&D Systems, following the manufacturer’s instructions. Flow cytometry Samples were acquired using a MACSQuant® 10 Analyzer Flow Cytometer, a MACSQuant® VYB Flow Cytometer (Miltenyi Biotec), or a BD FACSDiscover™ S8 Cell Sorter (BD Biosciences). For surface staining, cells were resuspended in PBS containing 5% FCS and incubated with the appropriate antibody cocktails and Fcγ Block Reagent (BD Biosciences) for 30 minutes at 4 ºC in the dark. Cells were then washed twice with PBS plus 5% FCS. For intracellular staining, following surface staining, cells were fixed and permeabilized using the FoxP3 Transcription Factor Buffer Kit (Miltenyi Biotec) according to the manufacturer’s protocol, and then incubated with intracellular antibodies for 30 minutes at 4 ºC in the dark. The cell surface expression of mutated calreticulin was detected using an anti-human mutated calreticulin antibody (CAL2 clone, Dianova), followed by an Alexa Fluor-633 secondary antibody (ThermoFisher). All the antibodies used are presented in Supplementary Table 4. The immunophenotyping of healthy donor PBMCs, patient PBMCs, and CD34+ progenitor cells was analyzed using Kaluza Software (Beckman Coulter). The hCD3 phenotyping samples from mice were analyzed using FlowJo™ Software. First, dimensionality reduction was performed using t-SNE. Subsequently, the FlowSOM algorithm was applied to the t-SNE data to conduct unsupervised clustering, enabling the identification of distinct cellular subsets based on phenotypic profiles. Western blot analysis Whole-cell extracts were prepared by lysing cells for 15 min on ice in RIPA lysis buffer (Sigma-Aldrich) supplemented with protease and phosphatase cocktail inhibitors (Roche). Protein concentration in cell lysates was quantified by Bradford (BioRad) using a BioTek Microplate Reader. Cell culture supernatants were centrifuged using a 50 kDa Amicon filter (Sigma-Aldrich) to concentrate mCALR. Whole-cell lysates and cell culture supernatants were separated through SDS-polyacrylamide gels and transferred to a nitrocellulose membrane (BioRad). Membranes were blocked with 5% milk powder in 0.1% Tween 20 (Sigma-Aldrich) in PBS (PBS-T) for 1 h at RT, followed by incubation with primary antibodies diluted in 2.5% milk PBS-T. Western Blotting Luminol Reagent (Thermoscience) was used to detect protein expression with light-sensitive films (Phenix Research). The following antibodies were used: Anti-mCALR (1:500, Dianova), anti-Bcl-2 (1:250, SantaCruz), anti-Bcl-xL (1:1000, CellSignaling) and anti-GAPDH (1:1000, SantaCruz). Xenograft in vivo model. Nonobese diabetic B-NDG mice (female, 5-week-old, Inotiv) were housed in sterile facilities for immunosuppressed animals at the Center for Biomedical Research of Aragon (CIBA). Animal protocols were approved by the University of Zaragoza’s Advisory Ethics Commission for Animal Research (code PI48/23). Mice were IV transplanted with 3×105 Luc/ZsGreen–expressing HEL mCALR+ cells or MARIMO cell line. Two days later, 5×106 CART3-mCALR for eGFP-transfected (MOCK) T cells were i.v. infused. Tumour burden was followed by bioluminescence using the IVIS system (IVIS Lumina XRMS In Vivo Imaging System). To measure tumor burden, mice were injected intraperitoneally with 150 mg/kg of D-luciferin, and luminescence was monitored at the indicated time points. Signal intensity was quantified as total flux (photons/sec/cm²/sr) using Living Image software (PerkinElmer). Mice were regularly examined for weight loss, signs of stress, or the development of hind limb paralysis and euthanized according to preset criteria. Peripheral blood was collected weekly from the submandibular vein and samples were stained for flow cytometry to assess tumor burden (hCD33⁺GFP⁺/total cells) and the human T cells (hCD45⁺hCD3⁺/total cells) and CART3-mCALR cells (hCD45⁺ hCD3⁺ GFP⁺/total cells) persistence with total cells defined as the sum of hCD45⁺ and mCD45⁺ cells in each sample (Antibody information in supplementary Table 4). Red blood cells were lysed with ACK buffer (ThermoFisher). Similarly, spleen, blood, and bone marrow at euthanization were analysed by flow cytometry. Additionally, ex vivo bioluminescence imaging was performed on harvested mouse organs using the IVIS system. For survival analysis, animals were monitored daily and euthanized upon reaching predefined humane endpoints. CAR-treated mice were sacrificed seven days after the death of the last control animal, corresponding to approximately 25% longer survival, as established in the experimental design. At the time of euthanasia, spleen, liver, bone marrow, and tumor tissues were collected for the analysis of T-cell migration and tumor burden. In cases where a mouse in the CAR-treated group died before the planned endpoint, the euthanasia of the remaining mice was postponed by an equivalent period (25% of the control group survival) counted from the day of that death. RNA sequencing and data analysis. For bulk RNA-Seq analysis, patient-derived primary CD34+ cells were enriched, as previously indicated. Total RNA was extracted using TRIzol™ Reagent (Invitrogen). Briefly, samples were lysed in TRIzol, mixed with chloroform (PanReac), and centrifuged to separate phases. The aqueous phase was collected, RNA was precipitated with isopropanol (PanReac), washed with 75% ethanol, and resuspended in RNase-free water (Merk). Additional patient data is given in Supplemental Table 3. Total RNA sequencing was performed by CeGaT (Germany) using the WTS Classic service. Briefly, rRNA was depleted, total RNA was analyzed, libraries were prepared, and sequencing was conducted using Illumina sequencing platforms (Read length: 2 x 100 bp, Output: 6 M clusters (10 Gb) per sample). FASTQ files were preprocessed to filter by read length and sequence quality (minimum length of 50 bp) and to exclude reads with excessive ambiguous bases (>15% Ns). This filtering was performed using the Prinseq tool. Control samples correspond to SRR30220813–SRR30220816 from the SRP526030 study. Reads were mapped to the human reference genome (GRCh38.p14 primary assembly) using HISAT2 v2.2.1. Alignment files in SAM format were converted to BAM format using SAMtools v1.21 . Transcript assembly was performed with StringTie v2.2.2, using the GRCh38.113 GTF annotation file from Ensembl. Differential expression analysis was carried out using DESeq2, edgeR, and voom. For single-cell RNA sequencing, cryopreserved cell suspensions were thawed, washed, and resuspended in RPMI 1640 medium supplemented with 10% fetal calf serum (FCS), following the guidelines from 10x Genomics (CG000447—Handbook Cell Thawing Protocols for Singlecell Assays, Rev. B). Cell viability and counts were assessed using acridine range/propidium iodide staining and an automated cell counter (Cellaca MX, Cenibra GmbH, Germany). Singlecell suspensions were then loaded onto a Chromium GEM-X Single Cell 3′ chip (10xGenomics), targeting 20,000 cells per sample, and processed using the Chromium Controller with the GEM-X Universal 3′ Gene Expression v4 kit (10x Genomics) according to the manufacturer’s instructions. The resulting libraries were sequenced on a NovaSeq X Plus (Illumina) using a 25B flow cell, achieving an average depth of approximately 40,000 reads per cell. Sequencing data were demultiplexed and processed with Cell Ranger (v9.0.1) using the GRCh38-2024-A reference genome. 15,782 cells were recovered for sample 1 (MARIMO cell line used for infusion) and 13,051 cells for sample 2 (pooled spleen residual tumor cells), with median gene counts of 3,248 and 2,042 per cell, respectively. Filtered feature-barcode matrices were subsequently analyzed in Seurat (v5.1.0). Cells were retained if they expressed between 600 and 6,000 genes per cell and had less than 20% mitochondrial gene content. Batch correction was performed using SCTransform. After quality control and filtering, the final high-quality libraries contained 13,861 (sample 1) and 9,661 (sample 2) cells, each expressing more than 2,000 genes per cell. Principal component analysis (PCA) and Uniform Manifold Approximation and Projection (UMAP) were computed from the top 30 principal components. Clustering was performed using the Louvain algorithm at a resolution of 0.5, and transcriptional clusters were identified using the FindAllMarkers function in Seurat. Cluster annotation was based on the top-ranked marker genes, and gene module scores were computed using the AddModuleScore function. Comparisons between clusters of interest were conducted using the FindMarkers function in Seurat (Wilcoxon rank-sum tests with Bonferroni correction), with the parameters logfc.threshold = 0, min.pct = 0, and min.diff.pct = −Inf to retain all detected features. Filtered differential expression results were subsequently refined using in-house scripts, applying a minimum adjusted p-value of 0.05 and a minimum log₂ fold change of 0.5.Supplementary Table 1. Kinetic binding parameters and functional activity of anti-mCALR antibody clones, as reported in the respective patents; Supplementary Table 2. Clinical characteristics of patients included in cytotoxicity assays; Supplementary Table 3. Clinical characteristics of patients included in the RNA-seq analysis; Supplementary Table 4. List of antibodies.--Supplementary Figure 1. Surface expression of CART3-mCALR by human scFv labelling detected by flow cytometry in primary T cells; Supplementary Figure 2. Proliferation of wildtype (WT) and mutated Calreticulin (CALR mut) K562, HEL and THP-1 cell lines using IncuCyte live-cell imaging by confluency analysis; Supplementary Figure 3. CART3-mCALR induces higher cytokine secretion levels compared to other constructs, as measured by Luminex of supernatant of a cytotoxicity at 4:1 E:T ratio against K562 cell line; Supplementary Figure 4. CAR-T cell cytotoxicity against cell lines expressing distinct mCALR variants; Supplementary Figure 5. Real-time cytotoxicity assay monitored by IncuCyte confluence analysis in mCALR-negative cell lines and mCALR-positive controls; Supplementary Figure 6. Cytotoxicity of anti-mCALR CAR-T cells against primary cardiomyocytes, cardiac fibroblasts, and PBMCs; Supplementary Figure 7; Supplementary Figure 8; Supplementary Figure 9; Supplementary Figure 10; Supplementary Figure 11; Supplementary Figure 12; Supplementary Figure 13; Supplementary Figure 14; Supplementary Figure 15; Supplementary Figure 16. Sequences of CARs constructs indicating the source patent for each sequence.This work was funded by the Instituto de Salud Carlos III (ISCIII) through the Strategic Action in Health (AES), 2025 call, Health R&D Projects – Strategic Lines of Health Research (project/grant number: PI25/00236). AR-L is funded by a Ramón y Cajal contract (RYC2022-036627-I), financed by MCIN/AEI/10.13039/501100011033 and the European Social Fund (ESF) “Investing in your future” and ASPANOA. Grant PROY_B61_24 "proyectos de Investigación, desarrollo e innovación (I+D+i) en líneas prioritarias y de carácter multidisciplinar" funded by Gobierno de Aragón to AR-L and DSM. The Instituto de Salud Carlos III (ISCIII) through the Spanish Network of Advanced Therapies (RICORS/TERAV+), project RD24/0014/0015, and co-funded by the European Union (EU) to AR-L, JP, DSM and EMG. Work in the JP laboratory is funded by CIBERINFEC-ConsorcioCentro de Investigación Biomédica en Red- (CB21/13/00087), CERTERA andTERAV+ from Institutode Salud Carlos III, FEDER (Fondo Europeo de Desarrollo Regional),Gobierno deAragón (Group B29_23R, and LMP139_21), Grants PID2020-113963RBI00 andPID2024-157582OB-I00from MCIN/ AEI/10.13039/501100011033 and private social initiatives(FARO, AECC, Dona Médula, ASPANOA, and Carrera de la Mujer de Monzón No 101018587). Grant PID2022-136554OA-I00 funded by MICIU/AEI 10.13039/501100011033 and the European Regional Development Fund (ERDF)/EU to DSM. Predoctoral Grant for Ibero-Americas in Doctoral studies University of Zaragoza-Santander University (ACP), and Predoctoral Grant from AECC (CP). This work is part of a project that has received funding from the European Research Council (ICoMICS grant agreement No 101018587).--Peer reviewedBMJ Publishing GroupInstituto de Salud Carlos IIIMinisterio de Ciencia, Innovación y Universidades (España)Agencia Estatal de Investigación (España)European CommissionAspanoaGobierno de AragónRed Española de Terapias AvanzadasFaro La RiojaAsociación Española Contra el CáncerDona Médula AragónAsociación Carrera de la Mujer Ciudad de MonzónUniversidad de ZaragozaBanco SantanderEuropean Research CouncilPesini, Cecilia [0000-0002-8707-2722]Oñate, Carmen [0000-0001-6949-3462]Calvo Pérez, Adanays [0000-0002-1040-977X]Santiago, Llipsy [0000-0002-1861-5981]Iglesias, Eldris [0009-0006-3761-3021]Bernal, Jorge Paúl [0009-0004-3238-742X]Araujo-Voces, Miguel [0000-0003-3360-4479]Paz Artigas, Laura [0000-0001-6139-5905]Roig, Francisco J. [0000-0002-8853-2428]Movilla, Nieves [0000-0002-0163-8378]García-Aznar, José Manuel [0000-0002-9864-7683]Olave, María Teresa [0000-0002-6326-5992]Azaceta, Gemma [0000-0001-5068-7355]Garrote, Marta [0000-0001-8571-1466]Gálvez Buerba, Eva Mª [0000-0001-6928-5516]Arias, Maykel [0000-0002-9730-2210]Pardo, Julián [0000-0003-0154-0730]Ramírez-Labrada, Ariel [0000-0002-3888-7036]Ramírez-Labrada, Ariel [aramirezlabrada@yahoo.es]Consejo Superior de Investigaciones Científicas [https://ror.org/02gfc7t72]202620262026info:eu-repo/semantics/datasethttp://purl.org/coar/resource_type/c_ddb1application/pdfhttp://hdl.handle.net/10261/425635reponame:DIGITAL.CSIC. Repositorio Institucional del CSICinstname:Consejo Superior de Investigaciones Científicas (CSIC)Inglés#PLACEHOLDER_PARENT_METADATA_VALUE##PLACEHOLDER_PARENT_METADATA_VALUE##PLACEHOLDER_PARENT_METADATA_VALUE##PLACEHOLDER_PARENT_METADATA_VALUE#info:eu-repo/grantAgreement/AEI/Plan Estatal de Investigación Científica y Técnica y de Innovación 2017-2020/PID2020-113963RB-I00info:eu-repo/grantAgreement/AEI/Plan Estatal de Investigación Científica y Técnica y de Innovación 2024-2027/PID2024-157582OB-I00info:eu-repo/grantAgreement/AEI/Plan Estatal de Investigación Científica y Técnica y de Innovación 2021-2023/PID2022-136554OA-I00info:eu-repo/grantAgreement/ERC//101018587Pesini, Cecilia; Gil Bellido, Mario; Millan, Lorena S.; Oñate, Carmen; Calvo Pérez, Adanays; Santiago, Llipsy; Iglesias, Eldris; Bernal, Jorge Paúl; Araujo-Voces, Miguel; Paz Artigas, Laura; García-Martínez, Laura; Roig, Francisco J.; Movilla, Nieves; García-Aznar, José Manuel; Olave, María Teresa; Azaceta, Gemma; Garrote, Marta; Alvarez-Larrán, A.; Gálvez Buerba, Eva Mª; Sánchez Martínez, Diego; Arias, Maykel; Pardo, Julián; Ramírez-Labrada, Ariel. Mutant calreticulin enables potent and selective CAR-T cell therapy in preclinical models of myeloproliferative neoplasms. http://dx.doi.org/10.1136/jitc-2025-012706. http://hdl.handle.net/10261/418999http://dx.doi.org/10.1136/jitc-2025-012706https://jitc.bmj.com/content/jitc/14/1/e012706/DC1/embed/inline-supplementary-material-1.pdfhttps://jitc.bmj.com/content/jitc/14/1/e012706/DC2/embed/inline-supplementary-material-2.pdfhttps://jitc.bmj.com/content/jitc/14/1/e012706/DC3/embed/inline-supplementary-material-3.pdfSíinfo:eu-repo/semantics/openAccessoai:digital.csic.es:10261/4256352026-05-22T06:33:51Z
score 15.811543