Supplementary files of Mutant calreticulin enables potent and selective CAR-T cell therapy in preclinical models of myeloproliferative neoplasms [dataset]

Under a Creative Commons BY - NC 4.0 license.-- Material and methods: Cell lines culture, genetic modifications, and drug treatment. The MARIMO (Acute myeloid leukemia), HEL (Erythroleukaemia cells homozygous for JAK2 V617F mutation), K562 (Chronic myelogenous leukemia, BCR-Abl+), and THP-1 (Acute m...

Descripción completa

Detalles Bibliográficos
Autores: Pesini, Cecilia, Gil Bellido, Mario, Millan, Lorena S., Oñate, Carmen, Calvo Pérez, Adanays, Santiago, Llipsy, Iglesias, Eldris, Bernal, Jorge Paúl, Araujo-Voces, Miguel, Paz Artigas, Laura, García-Martínez, Laura, Roig, Francisco J., Movilla, Nieves, García-Aznar, José Manuel, Olave, María Teresa, Azaceta, Gemma, Garrote, Marta, Alvarez-Larrán, A., Gálvez Buerba, Eva Mª, Sánchez Martínez, Diego, Arias, Maykel, Pardo, Julián, Ramírez-Labrada, Ariel
Tipo de recurso: conjunto de datos
Fecha de publicación:2026
País:España
Institución:Consejo Superior de Investigaciones Científicas (CSIC)
Repositorio:DIGITAL.CSIC. Repositorio Institucional del CSIC
OAI Identifier:oai:digital.csic.es:10261/425635
Acceso en línea:http://hdl.handle.net/10261/425635
Access Level:acceso abierto
Palabra clave:Adoptive cell therapy - ACT
Chimeric antigen receptor - CAR
Coagulopathy
Hematologic malignancies
Immunotherapy
http://metadata.un.org/sdg/3
Ensure healthy lives and promote well-being for all at all ages
Pathology
Descripción
Sumario:Under a Creative Commons BY - NC 4.0 license.-- Material and methods: Cell lines culture, genetic modifications, and drug treatment. The MARIMO (Acute myeloid leukemia), HEL (Erythroleukaemia cells homozygous for JAK2 V617F mutation), K562 (Chronic myelogenous leukemia, BCR-Abl+), and THP-1 (Acute monocytic leukemia, JAK2 wt) cell lines were cultured in RPMI medium (Sigma-Aldrich). The Steffen Koschmieder laboratory kindly provided the MARIMO cell line after an MTA agreement with the Yuichi Ishikawa laboratory. HEK293T, A549, HepG2, PANC-1, PC-3, MDA-MB-231, and NHCF-v cell lines were cultured in DMEM (Sigma-Aldrich). Mediums were supplemented with 10% fetal bovine serum (FBS, Capricorn Scientific) and 1% penicillin/streptomycin (Pen/Strep, Sigma-Aldrich). HEL, K562, and THP-1 tumor cell lines were genetically modified to express ZsGreen-FireFly Luciferase (ZsGreen-FFLuc) and mutated calreticulin (mCALR) using lentiviral particles, obtained by co-transfecting HEK293T cells with the psPAX2 (Addgene #12260), the pMD2.G plasmids (Addgene #12259), and the lentiviral interest plasmid (pCCL1 Luc-T2A-ZsGreen and pCCL1 mCALR-T2A-RFP), by using PEI (Sigma-Aldrich). The mCALR sequence identified in the MARIMO cell line (del61), resembling a type 1-like mutation, was used to transduce HEL, K562, and THP-1 cell lines. All resulting cell lines expressed luciferase, ZsGreen (wt), and mCALR-expressing cells (mCALR+) co-expressed RFP protein. Fluorescence-activated cell sorting was used to isolate modified cell populations based on fluorescent protein expression, and mCALR expression was validated by flow cytometry and immunoblotting. Proliferation was evaluated between wild-type and mCAR+ derivative cell lines by Incucyte (Supplementary Figure 2). To knock out mCALR in MARIMO cells, a lentiviral CRISPR/Cas9 system was employed using the lentiCRISPRv2 (Addgene #52961) and lentiGuide-Puro (Addgene #52963) plasmids. A specific single guide RNA (sgRNA) targeting the mCALR was designed following the system requirements and cloned into the BsmBI site of the lentiCRISPRv2 vector following the protocol by Shalem et al. 1. The oligo sequences used were: (oligo 1: CACCGACGAGGAGCAGAGGATGATG, oligo 2:AAACCATCATCCTCTGCTCCTCGTC, Life Technologies). Loss of mutant CALR expression was confirmed by immunoblotting (see below). For venetoclax treatment, the IC50 was determined for each cell line, and a dose below the calculated IC50 was selected for subsequent experiments (Supplementary Figure 15). hiPSC differentiation into cardiomyocytes (hiPSC-CMs) Human induced pluripotent stem cells (hiPSCs; IPSC0028, Sigma-Aldrich) were differentiated into cardiomyocytes. Briefly, hiPSCs were seeded on Matrigel-coated plates (Corning) at a density of 1.5 × 10⁵ cells/cm² in Essential 8 (E8) medium (Gibco). After 48 h, differentiation was induced using RPMI medium (Biowest) supplemented with B27 minus insulin (Gibco) and 9 μM CHIR99021 (Sigma-Aldrich) for 24 h, followed by 48 h in RPMI B27⁻. The medium was then replaced with a 1:1 mixture of conditioned and fresh RPMI B27⁻ containing 5 μM IWP2 (Labclinics) for 48 h, and subsequently with fresh RPMI B27⁻ for an additional 48 h. Cultures were then maintained in RPMI supplemented with B27 plus insulin (RPMI B27⁺) for 72 h. Cardiomyocytes were purified by 48 h incubation in glucose-free RPMI B27⁺ medium (Gibco) and passaged using TrypLE (Gibco). Cells were reseeded on Matrigel-coated plates in RPMI B27⁺ supplemented with 10 μM Y-27632 (Stem Cell Technologies) and 10% KnockOut serum (Gibco). After 24 h, medium was replaced with RPMI B27⁺ containing 2 μM CHIR99021 (expansion medium), refreshed every 48–72 h. Cells were expanded for up to four passages before use. To monitor hiPSC-CM purity, cells were analyzed by flow cytometry after each passage using cardiac Troponin T (cTnT) as a marker. Cells were fixed with 2% paraformaldehyde for 15 min at 4 °C, permeabilized and blocked with 0.1% saponin (MilliporeSigma) and 10% donkey serum (Sigma-Aldrich), and stained with BV421-conjugated anti-cTnT antibody (clone 13-11, BD Biosciences, 1:200). Samples were washed with PBS and analyzed by flow cytometry. Differentiation batches with <80% cTnT⁺ cells were excluded from experiments. Selection of single-chain variable fragment (scFv) and CAR construct design The mutated calreticulin-specific single-chain variable fragments (scFvs) were derived from different previously described antibodies: mCALR-CAR0, from the 8B2-H6 antibody (WO 2016/087514); mCALR-CAR1, from the B3 antibody (WO 2020/175689 A1); mCALR-CAR2, from antibody clone 4; mCALR-CAR3, from antibody clone 74; and mCALR-CAR4, from antibody clone 132 (all from WO 2023/107994, Supplementary Figure 16). The construct included a human CD8 hinge, a human CD8 transmembrane domain, a human 4-1BB endodomain, and the ζ signaling endodomain of the T cell receptor complex (CD3ζ). Additionally, a T2A-enhanced green fluorescent protein (ZsGreen) sequence was incorporated. The construct was synthesized commercially (GenScript) and cloned into a pCCL1 lentiviral backbone. An identical lentiviral vector expressing ZsGreen alone was used as a control (mock) where indicated.