Analysis of interaction between dendriplexes and bovine serum albumin.

[EN] Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTG...

Descripción completa

Detalles Bibliográficos
Autores: Shcharbin, Dzmitry, Pedziwiatr, Elzbieta, Chonco, Louis, Bermejo Martín, Jesús Francisco, Ortega, Paula, de la Mata, F Javier, Eritja, Ramon, Gómez, Rafael, Klajnert, Barbara, Bryszewska, Maria, Muñoz-Fernandez, Ma Angeles
Tipo de recurso: artículo
Estado:Versión publicada
Fecha de publicación:2007
País:España
Institución:Universidad de Salamanca (USAL)
Repositorio:GREDOS. Repositorio Institucional de la Universidad de Salamanca
OAI Identifier:oai:gredos.usal.es:10366/161089
Acceso en línea:http://hdl.handle.net/10366/161089
Access Level:acceso embargado
Palabra clave:Base Sequence
DNA Primers
Dendrimers
Serum Albumin, Bovine
Spectrometry, Fluorescence
Serum Albumin
secuencia de bases
albúmina sérica
dendrímeros
cebadores de ADN
Descripción
Sumario:[EN] Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery.