Analysis of interaction between dendriplexes and bovine serum albumin.
[EN] Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTG...
| Autores: | , , , , , , , , , , |
|---|---|
| Tipo de recurso: | artículo |
| Estado: | Versión publicada |
| Fecha de publicación: | 2007 |
| País: | España |
| Institución: | Universidad de Salamanca (USAL) |
| Repositorio: | GREDOS. Repositorio Institucional de la Universidad de Salamanca |
| OAI Identifier: | oai:gredos.usal.es:10366/161089 |
| Acceso en línea: | http://hdl.handle.net/10366/161089 |
| Access Level: | acceso embargado |
| Palabra clave: | Base Sequence DNA Primers Dendrimers Serum Albumin, Bovine Spectrometry, Fluorescence Serum Albumin secuencia de bases albúmina sérica dendrímeros cebadores de ADN |
| Sumario: | [EN] Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery. |
|---|