"RNA-Seq raw data of two maize near isogenic lines (NILs), NIL16 and NIL95, under infestation with Sesamia nonagrioides and control conditions"

The original raw data from Illumina platform were transformed to Sequenced Reads, known as Raw Data or RAW Reads, by base calling. Raw data are recorded in a FASTQ file, which contains sequencing reads and corresponding sequencing quality. Every read in FASTQ format is stored in four lines, as indic...

Descripción completa

Detalles Bibliográficos
Autores: Butrón Gómez, Ana María, Fernández, Carlos, Martínez, Paulino, Arnáiz Pita, Yolanda, Malvar Pintos, Rosa Ana
Tipo de recurso: conjunto de datos
Estado:Versión enviada para evaluación y publicación
Fecha de publicación:2026
País:España
Institución:Consejo Superior de Investigaciones Científicas (CSIC)
Repositorio:DIGITAL.CSIC. Repositorio Institucional del CSIC
OAI Identifier:oai:digital.csic.es:10261/420281
Acceso en línea:http://hdl.handle.net/10261/420281
Access Level:acceso abierto
Palabra clave:RNA-seq
Zea mays
Maize
Sesamia nonagrioides
Resistance
http://metadata.un.org/sdg/12
Ensure sustainable consumption and production patterns
id ES_36dccb14f7efd3bfc5e1df8ea49e3650
oai_identifier_str oai:digital.csic.es:10261/420281
network_acronym_str ES
network_name_str España
repository_id_str
dc.title.none.fl_str_mv "RNA-Seq raw data of two maize near isogenic lines (NILs), NIL16 and NIL95, under infestation with Sesamia nonagrioides and control conditions"
title "RNA-Seq raw data of two maize near isogenic lines (NILs), NIL16 and NIL95, under infestation with Sesamia nonagrioides and control conditions"
spellingShingle "RNA-Seq raw data of two maize near isogenic lines (NILs), NIL16 and NIL95, under infestation with Sesamia nonagrioides and control conditions"
Butrón Gómez, Ana María
RNA-seq
Zea mays
Maize
Sesamia nonagrioides
Resistance
http://metadata.un.org/sdg/12
Ensure sustainable consumption and production patterns
title_short "RNA-Seq raw data of two maize near isogenic lines (NILs), NIL16 and NIL95, under infestation with Sesamia nonagrioides and control conditions"
title_full "RNA-Seq raw data of two maize near isogenic lines (NILs), NIL16 and NIL95, under infestation with Sesamia nonagrioides and control conditions"
title_fullStr "RNA-Seq raw data of two maize near isogenic lines (NILs), NIL16 and NIL95, under infestation with Sesamia nonagrioides and control conditions"
title_full_unstemmed "RNA-Seq raw data of two maize near isogenic lines (NILs), NIL16 and NIL95, under infestation with Sesamia nonagrioides and control conditions"
title_sort "RNA-Seq raw data of two maize near isogenic lines (NILs), NIL16 and NIL95, under infestation with Sesamia nonagrioides and control conditions"
dc.creator.none.fl_str_mv Butrón Gómez, Ana María
Fernández, Carlos
Martínez, Paulino
Arnáiz Pita, Yolanda
Malvar Pintos, Rosa Ana
author Butrón Gómez, Ana María
author_facet Butrón Gómez, Ana María
Fernández, Carlos
Martínez, Paulino
Arnáiz Pita, Yolanda
Malvar Pintos, Rosa Ana
author_role author
author2 Fernández, Carlos
Martínez, Paulino
Arnáiz Pita, Yolanda
Malvar Pintos, Rosa Ana
author2_role author
author
author
author
dc.contributor.none.fl_str_mv Ministerio de Ciencia, Innovación y Universidades (España)
Agencia Estatal de Investigación (España)
European Commission
Butrón Gómez, Ana María [0000-0003-4202-5065]
Malvar Pintos, Rosa Ana [0000-0001-7915-4675]
Martínez, Paulino [0000-0001-8438-9305]
Fernández, Carlos [0000-0002-3064-1218]
Butrón Gómez, Ana María: abutron@mbg.csic.es
Butrón Gómez, Ana María:
Malvar Pintos, Rosa Ana
Arnáiz Pita, Yolanda
Fernández, Carlos
Martínez, Paulino
Butrón Gómez, Ana María
Consejo Superior de Investigaciones Científicas [https://ror.org/02gfc7t72]
dc.subject.none.fl_str_mv RNA-seq
Zea mays
Maize
Sesamia nonagrioides
Resistance
http://metadata.un.org/sdg/12
Ensure sustainable consumption and production patterns
topic RNA-seq
Zea mays
Maize
Sesamia nonagrioides
Resistance
http://metadata.un.org/sdg/12
Ensure sustainable consumption and production patterns
description The original raw data from Illumina platform were transformed to Sequenced Reads, known as Raw Data or RAW Reads, by base calling. Raw data are recorded in a FASTQ file, which contains sequencing reads and corresponding sequencing quality. Every read in FASTQ format is stored in four lines, as indicated below: @HWI-ST1276:71:C1162ACXX:1:1101:1208:2458 1:N:0:CGATGT NAAGAACACGTTCGGTCACCTCAGCACACTTGTGAATGTCATGGGATCCAT + #55???BBBBB?BA@DEEFFCFFHHFFCFFHHHHHHHFAE0ECFFD/AEHH Line 1 begins with a '@' character and is followed by the Illumina Sequence Identifiers and an optional description. The details of Illumina sequence identifier are listed in the table below. Identifier Meaning HWI-ST1276 Instrument – unique identifier of the sequencer 71 Run number – Run number on instrument C1162ACXX Flow Cell ID – ID of flow cell 1 Lane Number – positive integer 1101 Tile Number – positive integer 1208 X – x coordinate of the spot. Integer which can be negative 2458 Y – y coordinate of the spot. Integer which can be negative 1 Read number. 1 can be single read or Read 2 of paired-end. N Y if the read is filtered (did not pass), N otherwise. 0 Control number - 0 when none of the control bits are on, otherwise it is an even number CGATGT Illumina index sequences Line 2 is the raw sequence of the read. Line 3 begins with a '+' character and is optionally followed by the same sequence identifiers and descriptions as in Line 1. Line 4 encodes the quality values for the bases in Line 2 and contains the same number of characters as the bases in the read.
publishDate 2026
dc.date.none.fl_str_mv 2026
2026
2026
dc.type.none.fl_str_mv info:eu-repo/semantics/dataset
http://purl.org/coar/resource_type/c_ddb1
Preprint
info:eu-repo/semantics/submittedVersion
format dataset
status_str submittedVersion
dc.identifier.none.fl_str_mv http://hdl.handle.net/10261/420281
url http://hdl.handle.net/10261/420281
dc.language.none.fl_str_mv Inglés
language_invalid_str_mv Inglés
dc.relation.none.fl_str_mv #PLACEHOLDER_PARENT_METADATA_VALUE#
#PLACEHOLDER_PARENT_METADATA_VALUE#
info:eu-repo/grantAgreement/AEI/Plan Estatal de Investigación Científica y Técnica y de Innovación 2017-2020/RTI2018-096776-B-C21
info:eu-repo/grantAgreement/AEI/Plan Estatal de Investigación Científica y Técnica y de Innovación 2021-2023/PID2021-122196OB-C21
Genotypic and phenotypic data as well as the genetic map of the mapping population derived from the cross NIL16 x NIL95 are shown in a supplementary excel files of the published paper
Toward identifying genes that increase resistance to stem tunneling by Mediterranean corn borer in maize
https://doi.org/10.20350/digitalCSIC/18113
Sí
dc.rights.none.fl_str_mv info:eu-repo/semantics/openAccess
eu_rights_str_mv openAccess
dc.format.none.fl_str_mv FASTQ file
dc.publisher.none.fl_str_mv DIGITAL.CSIC
publisher.none.fl_str_mv DIGITAL.CSIC
dc.source.none.fl_str_mv reponame:DIGITAL.CSIC. Repositorio Institucional del CSIC
instname:Consejo Superior de Investigaciones Científicas (CSIC)
instname_str Consejo Superior de Investigaciones Científicas (CSIC)
reponame_str DIGITAL.CSIC. Repositorio Institucional del CSIC
collection DIGITAL.CSIC. Repositorio Institucional del CSIC
repository.name.fl_str_mv
repository.mail.fl_str_mv
_version_ 1869405993427795968
spelling "RNA-Seq raw data of two maize near isogenic lines (NILs), NIL16 and NIL95, under infestation with Sesamia nonagrioides and control conditions"Butrón Gómez, Ana MaríaFernández, CarlosMartínez, PaulinoArnáiz Pita, YolandaMalvar Pintos, Rosa AnaRNA-seqZea maysMaizeSesamia nonagrioidesResistancehttp://metadata.un.org/sdg/12Ensure sustainable consumption and production patternsThe original raw data from Illumina platform were transformed to Sequenced Reads, known as Raw Data or RAW Reads, by base calling. Raw data are recorded in a FASTQ file, which contains sequencing reads and corresponding sequencing quality. Every read in FASTQ format is stored in four lines, as indicated below: @HWI-ST1276:71:C1162ACXX:1:1101:1208:2458 1:N:0:CGATGT NAAGAACACGTTCGGTCACCTCAGCACACTTGTGAATGTCATGGGATCCAT + #55???BBBBB?BA@DEEFFCFFHHFFCFFHHHHHHHFAE0ECFFD/AEHH Line 1 begins with a '@' character and is followed by the Illumina Sequence Identifiers and an optional description. The details of Illumina sequence identifier are listed in the table below. Identifier Meaning HWI-ST1276 Instrument – unique identifier of the sequencer 71 Run number – Run number on instrument C1162ACXX Flow Cell ID – ID of flow cell 1 Lane Number – positive integer 1101 Tile Number – positive integer 1208 X – x coordinate of the spot. Integer which can be negative 2458 Y – y coordinate of the spot. Integer which can be negative 1 Read number. 1 can be single read or Read 2 of paired-end. N Y if the read is filtered (did not pass), N otherwise. 0 Control number - 0 when none of the control bits are on, otherwise it is an even number CGATGT Illumina index sequences Line 2 is the raw sequence of the read. Line 3 begins with a '+' character and is optionally followed by the same sequence identifiers and descriptions as in Line 1. Line 4 encodes the quality values for the bases in Line 2 and contains the same number of characters as the bases in the read.The objective of this study was to disentangle the genes behind co-localized QTLs for increased yield and stem susceptibility to the maize stem borer, Sesamia nonagrioides Lef. (Mediterranean stem borer, MSB) in the long arm of chromosome 8 of maize. Fine-mapping of QTLs for both traits was performed in a mapping population derived from two near isogenic lines (NILs), NIL16 and NIL95, and RNA-seq has been used to facilitate the identification of QTL candidate genes. RNA-seq analysis was done with RNA extracted from the stem pith of NIL16 and NIL95 collected 30 days after infestation in infested and control plants using four biological replicates for each NIL-treatment combination. Samples were barcoded and prepared for sequencing at Novogene Co., Ltd, where 150 bp paired-end (PE) reads were obtained on an Illumina 1.9.RTI2018-096776-B-C21 and PID2021-122196OB-C21 Projects funded by MCIU/AEI/FEDERSequences of 150 bp cDNA paired-end recorded in FASTQ format and contained in files fq.gz. Files (=reads) for each sample are saved in the same folder: Folder S_16_1: Infestation with Sesamia nonagrioides, NIL16, biological replicate 1: S_16_1_MKRN240010851-1A_22C2L2LT4_L4_1.fq.gz S_16_1_MKRN240010851-1A_22C2L2LT4_L4_2.fq.gz S_16_1_MKRN240010851-1A_22CHMWLT4_L8_1.fq.gz S_16_1_MKRN240010851-1A_22CHMWLT4_L8_2.fq.gz Folder S_16_2: Infestation with Sesamia nonagrioides, NIL16, biological replicate 2: S_16_2_MKRN240010852-1A_22F27GLT4_L8_1.fq.gz S_16_2_MKRN240010852-1A_22F27GLT4_L8_2.fq.gz Folder S_16_3: Infestation with Sesamia nonagrioides, NIL16, biological replicate 3: S_16_3_MKRN240010853-1A_22C2L2LT4_L4_1.fq.gz S_16_3_MKRN240010853-1A_22C2L2LT4_L4_2.fq.gz S_16_3_MKRN240010853-1A_22CHMWLT4_L8_1.fq.gz S_16_3_MKRN240010853-1A_22CHMWLT4_L8_2.fq.gz Folder S_16_4: Infestation with Sesamia nonagrioides, NIL16, biological replicate 4: S_16_4_MKRN240010854-1A_22F27GLT4_L8_1.fq.gz S_16_4_MKRN240010854-1A_22F27GLT4_L8_2.fq.gz Folder S_95_1: Infestation with Sesamia nonagrioides, NIL95, biological replicate 1: S_95_1_MKRN240010855-1A_22F27GLT4_L8_1.fq.gz S_95_1_MKRN240010855-1A_22F27GLT4_L8_2.fq.gz Folder S_95_2: Infestation with Sesamia nonagrioides, NIL95, biological replicate 2: S_95_2_MKRN240010856-1A_22F27GLT4_L8_1.fq.gz S_95_2_MKRN240010856-1A_22F27GLT4_L8_2.fq.gz Folder S_95_3: Infestation with Sesamia nonagrioides, NIL95, biological replicate 3: S_95_3_MKRN240010857-1A_22F27GLT4_L8_1.fq.gz S_95_3_MKRN240010857-1A_22F27GLT4_L8_2.fq.gz Folder S_95_5: Infestation with Sesamia nonagrioides, NIL95, biological replicate 4: S_95_5_MKRN240010858-1A_22F27GLT4_L8_1.fq.gz S_95_5_MKRN240010858-1A_22F27GLT4_L8_2.fq.gz Folder C_16_1: Control, NIL16, biological replicate 1: C_16_1_MKRN240010839-1A_22C2L2LT4_L4_1.fq.gz C_16_1_MKRN240010839-1A_22C2L2LT4_L4_2.fq.gz Folder C_16_2: Control, NIL16, biological replicate 2: C_16_2_MKRN240010840-1A_22C2LCLT4_L8_1.fq.gz C_16_2_MKRN240010840-1A_22C2LCLT4_L8_2.fq.gz Folder C_16_3: Control, NIL16, biological replicate 3: C_16_3_MKRN240010841-1A_22C2LCLT4_L8_1.fq.gz C_16_3_MKRN240010841-1A_22C2LCLT4_L8_2.fq.gz Folder C_16_4: Control, NIL16, biological replicate 4: C_16_4_MKRN240010842-1A_22C2LCLT4_L8_1.fq.gz C_16_4_MKRN240010842-1A_22C2LCLT4_L8_2.fq.gz Folder C_95_1: Control, NIL95, biological replicate 1: C_95_1_MKRN240010843-1A_22C2LCLT4_L8_1.fq.gz C_95_1_MKRN240010843-1A_22C2LCLT4_L8_2.fq.gz Folder C_95_2: Control, NIL95, biological replicate 2: C_95_2_MKRN240010844-1A_22F27GLT4_L7_1.fq.gz C_95_2_MKRN240010844-1A_22F27GLT4_L7_2.fq.gz Folder C_95_3: Control, NIL95, biological replicate 3: C_95_3_MKRN240010845-1A_22F27GLT4_L8_1.fq.gz C_95_3_MKRN240010845-1A_22F27GLT4_L8_2.fq.gz Folder C_95_4: Control, NIL95, biological replicate 4: C_95_4_MKRN240010846-1A_22F27GLT4_L8_1.fq.gz C_95_4_MKRN240010846-1A_22F27GLT4_L8_2.fq.gzNoDIGITAL.CSICMinisterio de Ciencia, Innovación y Universidades (España)Agencia Estatal de Investigación (España)European CommissionButrón Gómez, Ana María [0000-0003-4202-5065]Malvar Pintos, Rosa Ana [0000-0001-7915-4675]Martínez, Paulino [0000-0001-8438-9305]Fernández, Carlos [0000-0002-3064-1218]Butrón Gómez, Ana María: abutron@mbg.csic.esButrón Gómez, Ana María:Malvar Pintos, Rosa AnaArnáiz Pita, YolandaFernández, CarlosMartínez, PaulinoButrón Gómez, Ana MaríaConsejo Superior de Investigaciones Científicas [https://ror.org/02gfc7t72]202620262026info:eu-repo/semantics/datasethttp://purl.org/coar/resource_type/c_ddb1Preprintinfo:eu-repo/semantics/submittedVersionFASTQ filehttp://hdl.handle.net/10261/420281reponame:DIGITAL.CSIC. Repositorio Institucional del CSICinstname:Consejo Superior de Investigaciones Científicas (CSIC)Inglés#PLACEHOLDER_PARENT_METADATA_VALUE##PLACEHOLDER_PARENT_METADATA_VALUE#info:eu-repo/grantAgreement/AEI/Plan Estatal de Investigación Científica y Técnica y de Innovación 2017-2020/RTI2018-096776-B-C21info:eu-repo/grantAgreement/AEI/Plan Estatal de Investigación Científica y Técnica y de Innovación 2021-2023/PID2021-122196OB-C21Genotypic and phenotypic data as well as the genetic map of the mapping population derived from the cross NIL16 x NIL95 are shown in a supplementary excel files of the published paperToward identifying genes that increase resistance to stem tunneling by Mediterranean corn borer in maizehttps://doi.org/10.20350/digitalCSIC/18113Síinfo:eu-repo/semantics/openAccessoai:digital.csic.es:10261/4202812026-05-22T06:33:51Z
score 15,81155

Similares en LA Referencia